Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGTCCTTTGGGCCCAACCTCCCATCCGTGTCTATTGTACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTCTGCCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACACGAACCCTGTCTGAAAGCGTGCAGTCTGAGTCGATTGTTTGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCTCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCCAACCATTCTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAA
TTTCCCTCCCCGTCCCTCGTCTGTCAGGAGACGCGTCGTTGGTTGGCATCTCTTCTGATCGGGACCCCACCGGTTCTTCGACCAACTCAATCTTGTGCTAACTGCATGTCTTCGTCGCTTCATAGGTTCACCTCCAAACCGGCCAGTGTGTAAGTGCCAACATGTTCTTCGGATGATAGCCCCCAAGGGTTCTTGATTGGTGTTCGGTGGACTAAACAACATATCATGGTGGTTAGGGTAACCAAATTGGTGCTGCTTTCTGGTATGTATCCACTGCCACTGGATTGGGGATGGGACATCATCCATCAGGCTATCTCTCTCAGCTTGAGTTCGGATGATGTCCATTGGGTATATGTTGTCGGTATAACAACACGTCTAACAGTTCAACAGGCAGACCATCTCTGGCGAGCACGGCCTTGACGGCTCCGGTGTGTAAGTGCAACTTTTTTCACACCTCTCAATTGGTCAACAATGGGGAAAGGATTGGGTTTCCTGACGCGCAGGATAGTTACAATGGCACCTCCGACCTCCAGCTGGAGCGCATGAACGTTTACTTCAACCAY
Nucleotide (GenBank) : KU897015 beta-tubulin gene
Nucleotide (GenBank) : FJ195349 ITS including 5.8S rRNA gene
Sakano Y, et al. Pullulan 4-glucanohydrolase from Aspergillus niger. Arch. Biochem. Biophys. 153: 180-187, 1972. PubMed: 4650606
Inoue Y, et al. Metabolism of 2-ketoaldehydes in mold: purification and characterization of glyoxalase I from Aspergillus niger. J. Biochem. 102: 583-589, 1987. PubMed: 3123469
ASTM International Standard Test Methods for Ability of Adhesive Films to Support or Resist the Growth of Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4300-01.
ASTM International Standard Test Methods for Resistance of Adhesive Preparations in Container to Attack by Bacteria, Yeast, and Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4783-01e1.
ASTM International Standard Practice for Determining Resistance of Synthetic Polymeric Materials to Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method G 0021-96 (Reapproved 2002).
RTCA Environmental conditions and test procedures for airborne equipment -- Fungus resistance. Washington, DC:RTCA;RTCA DO-160C.
U.S. Department of Defense Insulation, electrical, synthetic-resin composition, nonrigid. Washington, DC:US Department of Defense;Military Specification MIL-I-631D, 1961
U.S. Department of Defense Wax, impregnating, waterproofing, for laminated paper tubes for small arms ammunition. Washington, DC:US Department of Defense;Military Specification MIL-W-10885B, 1956
U.S. Department of Defense Environmental test methods and engineering guidelines. Washington, DC:US Department of Defense;Military Standard MIL-STD-810F, 2000
Klausmeier RE. Results of the second interlaboratory experiment of biodeterioration of plastics. Int. Biodeterior. Bull. 8: 3-7, 1972.
Schmidt E, French DW. Two-day mold testing using a contact agar method. For. Prod. J. 29: 39-42, 1979.
Standard Specification for Cellulosic Fiber Loose-Fill Thermal Insulation. West Conshohocken, PA:ASTM International;ASTM Standard Test Method C 0739-05be1.
Standard Specification for Self-Supported Spray Applied Cellulosic Thermal Insulation. West Conshohocken, PA:ASTM International;ASTM Standard Test Method C 1149-06e1.
Standard Test Method for Determining Fungi Resistance of Insulation Materials and Facings. West Conshohocken, PA:ASTM International;ASTM Standard Test Method C 1338-00.
Standard Test Method for Using Seeded-Agar for the Screening Assessment of Antimicrobial Activity In Carpets. West Conshohocken, PA:ASTM International;ASTM Standard Test Method E 2471-05.
Varga J, et al. Aspergillus brasiliensis sp. nov., a biseriate black Aspergillus species with world-wide distribution. Int. J. Syst. Evol. Microbiol. 57: 1925-1932, 2007.
Miyazaki T, et al. Heterologous expression and characterization of processing alpha-glucosidase I from Aspergillus brasiliensis ATCC 9642. Glycoconj. J. 28: 563-571, 2011. PubMed: 22020441
Geiser DM, et al. The current status of species recognition and identification in Aspergillus. Stud Mycol 59: 1-10, 2007. PubMed: 18490947
