Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGAGTAAGGGTGCTCAGCGCCCGACCTCCAACCCTTTGTTGTTAAAACTACCTTGTTGCTTTGGCGGGACCGCTCGGTCTCGAGCCGCTGGGGATTCGTCCCAGGCGAGCGCCCGCCAGAGTTAAACCAAACTCTTGTTATTTAACCGGTCGTCTGAGTTAAAATTTTGAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCTATGCTTGGTATTGGGTGCCGTCCTTAGTTGGGCGCGCCTTAAAGACCTCGGCGAGGCCTCACCGGCTTTAGGCGTAGTAGAATTTATTCGAACGTCTGTCAAAGGAGAGGACTTCTGCCGACTGAAACCTTTATTTTTCTAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA
ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCTTCGGGTCCGCATTGTAATTTGTAGAGGATGCTTTGGGTGAAACGCCAGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACTGGAAATGTTAACCTATGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCGAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGTTTAAACTGTTCGGCCGGTCTTCTGACCGGTTTACTCAGTTTGGACAGGCCAGCATCAGTTTCGGCGGCCGGATAAAGGCTCTGGGAATGTGGCCTTCACTTCGGTGAAGGTGTTATAGCCCAGGGTGTAATACGGCCAGCCGGGACTGAGGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGAC
Nucleotide (GenBank) : KU933441 ITS including 5.8S rRNA gene
Nucleotide (GenBank) : KU933415 D1/D2 region of 28S rRNA gene
Catley BJ. The extracellular polysaccharide, pullulan, produced by Aureobasidium pullulans: a relationship between elaboration rate and morphology. J. Gen. Microbiol. 120: 265-268, 1980.
Heady RE. Process for the production of high fructose syrups and ethanol. US Patent 4,356,262 dated Oct 26 1982
Heady RE. Preparation of high fructose syrups from sucrose. US Patent 4,276,379 dated Jun 30 1981
Bock A, et al. Aureobasidium pullulans strain, process for its preparation, and use thereof. US Patent 5,019,514 dated May 28 1991
ASTM International Standard Test Method for Resistance to Growth of Mold on the Surface of Interior Coatings in an Environmental Chamber. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 3273-00 (Reapproved 2005).
ASTM International Standard Test Methods for Ability of Adhesive Films to Support or Resist the Growth of Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4300-01.
ASTM International Standard Test Methods for Resistance of Adhesive Preparations in Container to Attack by Bacteria, Yeast, and Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4783-01e1.
Deutsches Institut fur Normung Testing of plastics: Influence of fungi and bacteria; visual evaluation, change in mass or physical properties. Berlin, Germany:Deutsches Institut fur Normung;DIN DIN 53739.
IEC Basic environmental testing procedures: Mould growth. Geneva (Switzerland):International Electrotechnical Commission;IEC 60068-2-10, Part 2, Test J.
Klausmeier RE. Results of the second interlaboratory experiment of biodeterioration of plastics. Int. Biodeterior. Bull. 8: 3-7, 1972.
Catley BJ, Hutchinson A. Elaboration of pullulan by spheroplasts of Aureobasidium pullulans. Trans. Br. Mycol. Soc. 76: 451-456, 1981.
West TP, Reed-Hamer B. Effect of Ph on pullulan production relative to carbon source and yeast extract composition of growth medium. Microbios 75: 75-82, 1993.
Environmental testing. Part 2.10: Tests--Test J and guidance: Mould growth. Sydney, NSW, Australia:Standards Australia;Standards Australia AS 60068.2.10-2003.
Fibre Optic interconnecting divices and passive components --Basic test and measurement procedures--Part 2-16: Tests --Mould growth. Geneva (Switzerland):International Electrotechnical Commission;IEC 1300-2-16, 1995
Plastics--Evaluation of the action of micro-organisms. Geneva (Switzerland):International Organization for Standardization/ANSI;ISO ISO 846:1997.
Testing of textiles -- Evaluation of the action of microfungi. London, UK:British Standards Institution;British Standard BS EN 14119:2003, 2003
Standard method of evaluating the resistance of wood product surfaces to mold growth. Birmingham, AL: American Wood-Preservers' Association; AWPA E24-06, 2006
Plastics - Evaluation of the action of microorganisms. London, UK:British Standards Institution;British Standard BS EN ISO 846:1997.
Loncaric I, et al. Phenotypic and genotypic diversity among strains of Aureobasidium pullulans in comparison with related species. Antonie van Leeuwenhoek 95: 165-178, 2009. PubMed: 19123008
Zalar P, et al. Redefinition of Aureobasidium pullulans and its varieties. Stud Mycol 61: 21-38, 2008. PubMed: 19287524
