Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Yes
ACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGAATTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCCGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGGTCAGACTTGGTTTTACCAGGCCAGCATCAGTTTGGACGGCAGGATAATAGCTAAGAAATGTGACTCCACCTCGGTGGTGTGTTATAGTCTTGGTTGATACTGCCTGTCTAGACTGAGGACTGCGTCTTTGACTAGGATGCT
Nucleotide (GenBank) : AEIM00000000 Candida tenuis ATCC 10573, whole genome shotgun sequencing project
Groenewald M, Robert V, Smith MT. The value of the D1/D2 and internal transcribed spacers (ITS) domains for the identification of yeast species belonging to the genus Yamadazyma. Persoonia 26: 40-46, 2011. PubMed: 22025802
Wohlbach DJ, et al. Comparative genomics of xylose-fermenting fungi for enhanced biofuel production. Proc. Natl. Acad. Sci. USA 108: 13212-13217, 2011. PubMed: 21788494
Sugita T, Nakase T. Non-universal usage of the leucine CUG codon and the molecular phylogeny of the genus Candida. Syst Appl Microbiol 22: 79-86, 1999. PubMed: 10188281
Suzuki M, Nakase T. Cellular neutral sugar compositions and ubiquinone systems of the genus Candida. Microbiol. Cult. Collect. 14: 49-62, 1998.
Kurtzman CP, Robnett CJ. Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5' end of the large-subunit (26S) ribosomal DNA gene. J Clin Microbiol 35: 1216-1223, 1997. PubMed: 9114410
Diddens HA, Lodder J. Die anaskosporogenen Hefen, zweite Halfte. Amsterdam: North-Holland; 1942.
