Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Yes
GTAGCCAAAACACACTGAGTATAACTTCTAGGCTAATACACATACAACCGATTTATCTAAATCTCCTCCCAACGGATCTCTTGGCTCTCGCGACGATGAAGAACGCAGCGATCCGCGATACGTCCTGGAAGCCGCCGTGAACCATCAATTTTCGAACGCACATTGCATACAGGGAGGGTGGGGTGAGTCAATTCTCACACTCGTGGTCTAGTTTACAAAGGATGACTAATAACTTCGTCAGCCCTTACCGTTTTCTCCCCCGCCCCCTCAGA
GCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGTCCACCTTTGAAGTATTGACGTGGTTGGGAGAGGTTATTGCACAAGTCGCCTGGAACGGCCGCCAAAGAGGGTGATAGCCCCGTAGCATACAACCAATCTTCCCAGCCGACAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAAGGTGGTAGGGTCCATCAAAGACTAAATATCAGCGAGAGACCGATAGCAAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAACAGTGCGTGAAATTGGGGGGAGGGAAGGCAAGGCCACGACAGTGGTCCTGCGC
Nucleotide (GenBank) : JQ070155 D1/D2 region of 28S rRNA gene
Nucleotide (GenBank) : KU729078 ITS including 5.8S rRNA gene
Nucleotide (GenBank) : CABH00000000 Komagataella pastoris DSMZ 70382, whole genome shotgun sequencing project
Duff SJB. Use of colloidal particles to improve the biocatalytic activity of microorganisms. Agric Biol Chem 54: 1879-1882, 1990.
Duff SJB, Murray WD, Overend RP. Oxygen and temperature effects on acetaldehyde-induced catabolite inactivation in Pichia pastoris. Appl Microbiol Biotechnol 36: 82-86, 1991.
Duff SJ, Murray WD. Comparison of free and immobilized Pichia pastoris cells for conversion of ethanol to acetaldehyde. Biotechnol. Bioeng. 31: 790-795, 1988.
Duff SJ, Murray WD. Oxidation of benzyl alcohol by whole cells of Pichia pastoris and by alcohol oxidase in aqueous and nonaqueous reaction media. Biotechnol. Bioeng. 34: 153-159, 1989.
Duff SJ, Murray WD. Production and application of methylotrophic yeast Pichia pastoris. Biotechnol. Bioeng. 31: 44-49, 1988.
Duff SJB, et al. Production of natural flavor aldehydes from natural source primary alcohols C2-C7. US Patent 4,871,669 dated Oct 3 1989
Duff SJ, Murray WD. Production of flavor aldehydes using nongrowing whole cells of Pichia pastoris. Ann. N.Y. Acad. Sci. 542: 428-433, 1988.
Duff SJB, Murray WD, Overend RP. Factors affecting the yeast-mediated conversion of ethanol to acetaldehyde in batch reactors. Enzyme Microb Technol 11: 770-775, 1989.
Mattanovich D, et al. Genome, secretome and glucose transport highlight unique features of the protein production host Pichia pastoris. Microb. Cell Fact. 8: 29, 2009.
Murray WD, et al. Catabolite inactivation in the methylotrophic yeast Pichia pastoris. Appl. Environ. Microbiol. 56: 2378-2383, 1990.
Murray WD, et al. Induction and stability of alcohol oxidase in the methylotrophic yeast Pichia pastoris. Appl. Microbiol. Biotechnol. 32: 95-100, 1989.
Murray WD, Duff SJB. Metabolism of hydrogen peroxide by Pichia pastoris. Agric. Biol. Chem. 54: 1967-1974, 1990.
Phaff HJ. A proposal for amendment of the diagnosis of the genus Pichia Hansen. Antonie van Leeuwenhoek 22: 113-116, 1956.
Wegner EH. Treatment of make-up water for use in a fermentation process for growth of yeast cells requiring growth factors. US Patent 4,226,939 dated Oct 7 1980
Yamada Y, et al. The phylogenetic relationships of methanol-assimilating yeasts based on the partial sequences of 18S and 26S ribosomal RNAs: the proposal of Komagataella gen. nov. (Saccharomycetaceae). Biosci. Biotechnol. Biochem. 59: 439-444, 1995. PubMed: 7766181
Kurtzman CP, Robnett CJ. Relationships among genera of the Saccharomycotina (Ascomycota) from multigene phylogenetic analysis of type species. FEMS Yeast Res. 13: 23-33, 2013. PubMed: 22978764
Kurtzman CP. Komagataella populi sp. nov. and Komagataella ulmi sp. nov., two new methanol assimilating yeasts from exudates of deciduous trees. Antonie van Leeuwenhoek 101: 859-868, 2012. PubMed: 22302468
Kurtzman CP, Robnett CJ. Systematics of methanol assimilating yeasts and neighboring taxa from multigene sequence analysis and the proposal of Peterozyma gen. nov., a new member of the Saccharomycetales. FEMS Yeast Res 10: 353-361, 2010. PubMed: 20522116
Kurtzman CP. Biotechnological strains of Komagataella (Pichia) pastoris are Komagataella phaffii as determined from multigene sequence analysis. J Ind Microbiol Biotechnol 36: 1435-1438, 2009. PubMed: 19760441
Kurtzman CP, Robnett CJ, Basehoar-Powers E. Phylogenetic relationships among species of Pichia, Issatchenkia and Williopsis determined from multigene sequence analysis, and the proposal of Barnettozyma gen. nov., Lindnera gen. nov. and Wickerhamomyces gen. nov.. FEMS Yeast Res. 8: 939-954, 2008. PubMed: 18671746
