Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGAAATTTAATAATTTTGAAAATGGATTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACTGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAAACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATCTATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTCCAAAGAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAACTGCGGCTAATCTTTTTTTATACTGAGCGTATTGGAACGTTATCGATAAGAAGAGAGCGTCTAGGCGAACAATGTTCTTAAAGTTTGACCTCAAATCAGGTAGGAGTAC
ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGC
Stevens A. Pyrimidine-specific cleavage by an endoribonuclease of Saccharomyces cerevisiae. J. Bacteriol. 164: 57-62, 1985. PubMed: 3900048
Inoue Y, et al. Lipid hydroperoxide-resistance gene in Saccharomyces cerevisiae: utilization as a selectable marker gene for yeast transformation. Biotechnol. Appl. Biochem. 17: 305-310, 1993. PubMed: 8338639
Poliana J, Wiggs MY. STA10: A gene involved in the control of starch utilization by Saccharomyces. Curr. Genet. 7: 109-112, 1983. PubMed: 24173151
Kyle KM, Harauz G. Structure of ribosomal subunits from Saccharomyces cerevisiae. Micron Microsc. Acta 23: 273-286, 1992.
Mitra SK, et al. Specificity of AAG codon recognition by lysyl transfer ribonucleic acid from yeast. J. Biol. Chem. 246: 5854-5856, 1971. PubMed: 4938043
Sagliocco F, et al. Identification of proteins of the yeast protein map using genetically manipulated strains and peptide-mass fingerprinting. Yeast 12: 1519-1533, 1996. PubMed: 8972575
Casaregola S, et al. A family of laboratory strains of Saccharomyces cerevisiae carry rearrangements involving chromosomes I and III. Yeast 14: 551-564, 1998. PubMed: 9605505
McCullough MJ, et al. Intergenic transcribed spacer PCR ribotyping for differentiation of Saccharomyces species and interspecific hybrids. J Clin Microbiol 36: 1035-1038, 1998. PubMed: 9542932
Degrassi G, et al. Purification and properties of an esterase from the yeast Saccharomyces cerevisiae and identification of the encoding gene. Appl. Environ. Microbiol. 65: 3470-3472, 1999. PubMed: 10427036
Feldmann H, et al. Methionine specific transfer ribonucleic acids from brewer's yeast and a haploid yeast strain. Hoppe-Seyler's Z. Physiol. Chem. 352: 1231-1247, 1971. PubMed: 5096067
Stella CA, Burgos HI. Effect of potassium on Saccharomyces cerevisiae resistance to fluconazole. Antimicrob. Agents Chemother. 45: 1589-1590, 2001. PubMed: 11302836
Compagno C, et al. Production of fructose diphosphate by bioconversion of molasses with Saccharomyces cerevisiae cells. Biotechnol. Lett. 14: 495-498, 1992.
Cabib E, Ulane R. Chitin synthetase activating factor from yeast, a protease. Biochem. Biophys. Res. Commun. 50: 186-191, 1973. PubMed: 4567083
Hoang ML, et al. Competitive repair by naturally dispersed repetitive DNA during non-allelic homologous recombination. PLoS Genet. 6: e1001228, 2010. PubMed: 21151956
Miura F, et al. A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci USA 103: 17846-17851, 2006. PubMed: 17101987
Fay JC, Benavides JA. Evidence for domesticated and wild populations of Saccharomyces cerevisiae. Plos Genet. 1: e5-e5, 2005. PubMed: 16103919
Deutschbauer AM, Davis RW. Quantitative trait loci mapped to single-nucleotide resolution in yeast. Nat. Genet. 37: 1333-1340, 2005. PubMed: 16273108
Fay JC, et al. Population genetic variation in gene expression is associated with phenotypic variation in Saccharomyces cerevisiae. Genome Biol. 5: R26, 2004. PubMed: 15059259
Marinangeli P, et al. Minisatellites in Saccharomyces cerevisiae genes encoding cell wall proteins: a new way towards wine strain characterization. FEMS Yeast Res. 4: 427-435, 2004. PubMed: 14734023
Leh-Louis V, et al. Expansion and contraction of the DUP240 multigene family in Saccharomyces cerevisiae populations. Genetics 167: 1611-1619, 2004. PubMed: 15342502
Kellis M, et al. Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423: 241-254, 2003.
Brachat S, et al. Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol. 4: R45-R45, 2003. PubMed: 12844361
Muller O, et al. Role of the Vtc proteins in V-ATPase stability and membrane trafficking. J Cell Sci 116: 1107-1115, 2003. PubMed: 12584253
Maruyama R, et al. The enzymes with benzil reductase activity conserved from bacteria to mammals. J. Biotechnol. 94: 157-169, 2002. PubMed: 11796169
Cheeseman IM, et al. Mitotic spindle integrity and kinetochore function linked by the Duo1p/Dam1p complex. J. Cell Biol. 152: 197-212, 2001. PubMed: 11149931
Jensen MA, et al. Molecular population genetics and evolution of a prion-like protein in Saccharomyces cerevisiae. Genetics 159: 527-535, 2001. PubMed: 11606530
