Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Yes
ATATCATTAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAGAGCTCAAATTTGAAAGCTGGTACCTTCGGTATCCGCGTTGTAACCTCGAGACACGTTTTCCGTGCGGCGCTATGGACAAGTTCCTTGGAACAGGACATCGTAGAGGGTGAAAATCCCGTACTTGCCATGGATGTACCGTGCTTTGCGATACGTGCTCTAAGAGTCGAGTTGTTTGGGATTGCAGCTCAAAATGGGTGGTAGACTCCATCTAAAGCTAAATATCGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAGTACGTGAAATTGTCGAAAGGGAAGCGCTTGAAGTCAGCCATGCCGCTCAGGACTCAGCCTGGCTTTTGCTTGGTGTATTTCCTGGGTAGCAAGTCAGCATTGGTTTGGATCGTCGGAGAAGCATAGTCGGAATGTGGCGCCCTCGGGCGTGTTATAGCCTTCTATTGGATACGACGATCTAGACCAAGGAACGCAGCGCGCCTTATGGCGGGTCTTCGGACACCTTCGCGCTTAGGATGCTGGCGTAATGGCTTTAAGTGGC
Nucleotide (GenBank) : KU729140 D1/D2 region of 26S rRNA gene
Benham RW. The cultural characteristics of Pityrosporum ouale. A lipophilic fungus. J Invest Dermatol 2: 187–203, 1939.
Benham RW. The cultural characteristics of Pityrosporum ovale. A lipophilic fungus. Nutrient and growth requirements. Proc Soc Exp Biol Med 46: 176-178, 1941.
Benham RW. Pityrosporum ovale. A lipophilic fungus. Thiamin and oxaloacetic acid as growth factors. Proc Soc Exp Biol Med 58: 199-201, 1945.
Lodder J. The yeasts: a taxonomic study. 2nd ed. Amsterdam: North-Holland; 1970.
Castellá G, Coutinho SD, Caba?es FJ. Phylogenetic relationships of Malassezia species based on multilocus sequence analysis. Med. Mycol. 52: 99-105, 2014. PubMed: 23902157
Cafarchia C, et al. Physiological and molecular characterization of atypical lipid-dependent Malassezia yeasts from a dog with skin lesions: adaptation to a new host? Med Mycol 49: 365-374, 2011. PubMed: 21070187
Gonzalez A, et al. Physiological and molecular characterization of atypical isolates of Malassezia furfur. J Clin Microbiol 47: 48-53, 2009. PubMed: 18971363
Caba?es FJ, et al. Two New lipid-dependent Malassezia species from domestic animals. FEMS Yeast Res. 7(6): 1064-1076, 2007. PubMed: 17367513
Brunke S, Hube B. MfLIP1, a gene encoding an extracellular lipase of the lipid-dependent fungus Malassezia furfur. Microbiology 152: 547-554, 2006. PubMed: 16436442
Matheny PB, et al. Resolving the phylogenetic position of the Wallemiomycetes: an enigmatic major lineage of Basidiomycota. Can J Bot 84: 1794-1805, 2006.
Cabanes FJ, Hernandez JJ, Castella G. Molecular analysis of Malassezia sympodialis-related strains from domestic animals. J Clin Microbiol 43: 277-283, 2005. PubMed: 15634983
Gupta AK, et al. Identification and typing of Malassezia species by amplified fragment length polymorphism and sequence analyses of the internal transcribed spacer and large-subunit regions of ribosomal DNA. J Clin Microbiol 42: 4253-4260, 2004. PubMed: 15365020
Guillot J, et al. Confirmation of the nomenclatural status of Malassezia pachydermatis. Antonie van Leeuwenhoek 67: 173-176, 1995. PubMed: 7771764
Guillot J, Gueho E. The diversity of Malassezia yeasts confirmed by rRNA sequence and nuclear DNA comparisons. Antonie van Leeuwenhoek 67: 297-314, 1995. PubMed: 7778898
Gueho E, Meyer SA. A reevaluation of the genus Malassezia by means of genome comparison. Antonie van Leeuwenhoek 55: 245-251, 1989. PubMed: 2757367
Neotype of Pityrosporum ovale
