Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
ATGCACCGGTGATAAGATGTTACCTACGTAACGACTTATAATGATCTTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTAAACGTTACTTCGGTAACTTAATATCCTTAACACCTGTGCATCTTGTCGCTCCGGCGATATTATACAAACATCAGTGTAAAGAATGTATTATATTATAACAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCTTTTGGTATTCCGAAAGGCATGCCTGTTTGAGTGTCATAAAAACTCTCATACCTAGTTTTCTATGTATGAGCTTTGGACGCTGCCATCCGTGGCTCGTCTTAAATGACTAAGTGGAATGCGTAATAAGTTTTCGCTCCCTCCACTCTAACAACCTTTATGTTAGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGGA
Nucleotide (GenBank) : AF075482 26S ribosomal RNA gene, partial sequence
Nucleotide (GenBank) : EU252551 ITS including 5.8S rRNA gene
Katsu M, et al. The internal transcribed spacers and 5.8S rRNA gene show extensive diversity among isolates of the Cryptococcus neoformans species complex. FEMS Yeast Res. 4: 377-388, 2004. PubMed: 14734018
Scorzetti G, et al. Systematics of basidiomycetous yeasts: a comparison of large subunit D1/D2 and internal transcribed spacer rDNA regions. FEMS Yeast Res. 2: 495–517, 2002. PubMed: 12702266
Bai FY, Takashima M, Nakase T. Description of Bullera kunmingensis sp. nov., and clarification of the taxonomic status of Bullera sinensis and its synonyms based on molecular phylogenetic analysis. FEM Yeast Res. 1: 103-109, 2001. PubMed: 12702355
Fell JW, et al. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int. J. Syst. Evol. Microbiol. 50: 1351-1371, 2000. PubMed: 10843082
Skinner CE. Genetic name for imperfect yeasts, Cryptococccus or Torulopsis?. Am. Midl. Nat. 43: 242-250, 1950.
Wang QM, Bai FY. Molecular phylogeny of basidiomycetous yeasts in the Cryptococcus luteolus lineage (Tremellales) based on nuclear rRNA and mitochondrial cytochrome b gene sequence analyses: proposal of Derxomyces gen. nov. and Hannaella gen. nov., and description of eight novel Derxomyces species. FEMS Yeast Res 8: 799-814, 2008. PubMed: 18616607
