
Developed by the leaders in microbial cultivation and preservation, ATCC® Minis provide a convenient, ready-to-use solution for handling quality control strains. ATCC® Minis are authenticated and backed by ATCC polyphasic testing – ensuring the same consistent and reliable reference materials you’ve come to trust for ATCC Genuine Cultures®. It is easy to ensure the quality of your products with ATCC® Minis – just open, plate, and go! .

Ghannoum MA, et al. Interlaboratory study of quality control isolates for a broth microdilution method (modified CLSI M38-A) for testing susceptibilities of dermatophytes to antifungals. J. Clin. Microbiol. 44: 4353-4356, 2006. Ref
Espinel-Ingroff A, et al. Quality control and reference guidelines for CLSI broth microdilution susceptibility method (M38-A document) for amphotericin B, itraconazole, posaconazole, and voriconazole. J. Clin. Microbiol. 43: 5243-5246, 2005.Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
AGGATCATTACTGTGATTTAGTACTACACTGCGTGAGCGGAACGAAAACAACAACACCTAAAATGTGGAATATAGCATATAGTCGACAAGAGAAATCTACGAAAAACAAACAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACCTAGTGTGAATTGCAGCCATCGTGAATCATCGAGTTCTTGAACGCACATTGCGCCCCTCGGCATTCCGGGGGGCATGCCTGTTTGAGCGTCGTTTCCATCTTGCGCGTGCGCAGAGTTGGGGGAGCGGAGCGGACGACGTGTAAAGAGCGTCGGAGCTGCGACTCGCCTGAAAGGGAGCGAAGCTGGCCGAGCGAACTAGACTTTTTTTCAGGGACGCTTGGCGGCCGAGAGCGAGTGTTGCGAGACAACAAAAAGCTCGACCTCAAATCAGGTAGGAATACCCGCTGAACTTAAG
CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAGAGCTCAGATTTGAAATCGTGCTTTGCGGCACGAGTTGTAGATTGCAGGTTGGAGTCTGTGTGGAAGGCGGTGTCCAAGTCCCTTGGAACAGGGCGCCCAGGAGGGTGAGAGCCCCGTGGGATGCCGGCGGAAGCAGTGAGGCCCTTCTGACGAGTCGAGTTGTTTGGGAATGCAGCTCCAAGCGGGTGGTAAATTCCATCTAAGGCTAAATACTGGCGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAACAGCACGTGAAATTGTTGAAAGGGAAGGGTATTGCGCCCGACATGGGGATTGCGCACCGCTGCCTCTCGTGGGCGGCGCTCTGGGCTTTCCCTGGGCCAGCATCGGTTCTTGCTGCAGGAGAAGGGGTTCTGGAACGTGGCTCTTCGGAGTGTTATAGCCAGGGCCAGATGCTGCGTGCGGGGACCGAGGACTGCGGCCGTGTAGGTCACGGATGCTGGCAGAACGGCGCAACACCG
Nucleotide (GenBank) : AX109706 Sequence 439 from Patent WO0123604.
Nucleotide (GenBank) : M60305 C. krusei small subunit ribosomal RNA.
Nucleotide (GenBank) : S75391 cytochrome P-450 lanosterol-alpha-demethylase [Issatchenkia
Nucleotide (GenBank) : AF250036 Issatchenkia orientalis strain ATCC 6258 ABC transporter Abc1p
Nucleotide (GenBank) : AF250037 Issatchenkia orientalis strain ATCC 6258 ABC transporter Abc2p
Nucleotide (GenBank) : KC601852 ITS including 5.8S rRNA gene
Nucleotide (GenBank) : KC601854 D1/D2 region of 28S rRNA gene
Rudek W. Esterase activity in Candida species. J Clin Microbiol 8: 756-759, 1978. PubMed: 370150
Zeng S, et al. Random amplified polymorphic DNA analysis of culture collection strains of Candida species. J Med Vet Mycol 34: 293-297, 1996. PubMed: 8873891
Castellani AJ. Note on the importance of hyphomycetes and other fungi in tropical pathology. Br. Med. J. 2: 1208-1212, 1912.
Brenner DJ, et al. Multisite reproducibility of colorimetric broth microdilution method for antifungal susceptibility testing of yeast isolates. J Clin Microbiol 32: 1625-1628, 1994. PubMed: 7929747
Pfaller MA, et al. Selection of candidate quality control isolates and tentative quality control ranges for in vitro susceptibility testing of yeast isolates by National Committee for Clinical Laboratory Standards proposed standard methods. J Clin Microbiol 32: 1650-1653, 1994. PubMed: 7929752
Espinel-Ingroff A, et al. Comparison of two alternative microdilution procedures with the National Committee for Clinical Laboratory Standards reference macrodilution method M27-P for in vitro testing of fluconazole-resistant and -susceptible isolates of Candida albicans. J Clin Microbiol 33: 3154-3158, 1995. PubMed: 8586692
Rex JH, et al. Quality control guidelines for National Committee for Clinical Laboratory Standards--recommended broth macrodilution testing of ketoconazole and itraconazole. J. Clin. Microbiol. 34: 816-817, 1996. PubMed: 8815089
Davey KG, et al. Comparative evaluation of FUNGITEST and broth microdilution methods for antifungal drug susceptibility testing of Candida species and Cryptococcus neoformans. J Clin Microbiol 36: 926-930, 1998. PubMed: 9542910
Sensititre™ YeastOne. Thermo Scientific™ Sensititre™ Systems, Trek Diagnostic Systems.
Quality Control MIC Limits for Broth Microdilution Informational Supplement. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M27-S3.
Method for Antifungal Disk Diffusion Susceptibility Testing of Yeast; Approved Guideline. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M44-A2.
Supplemental assay method for testing growth promoting qualities of fluid thioglycollate medium and soybean-casein digest medium using Bacillus Subtilis spores and Candida krusei as the indicator organisms. :US Department of Agriculture;USDA, Center for Veterinary Biologics STSAM0900.01, 1999
Supplemental assay method for testing growth-promoting qualities of brain heart infusion agar using Bacillus subtilis spores and Candida krusei as indicator organisms. :US Department of Agriculture;USDA, Center for Veterinary Biologics STSAM0902.01, 1999
Supplemental assay method for testing for preservative interference with sterility tests. :US Department of Agriculture;USDA, Center for Veterinary Biologics STSAM0903.01, 1999
VITEK 2 Antifungal AST Card. bioMerieux.
Reference Method for Broth Dilution Antifungal Susceptibility Testing of Filamentous Fungi: Approved Standard - 2nd Edition. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M38-A2.
VITEK 2 AST-YS QC Set. bioMerieux.
Ghannoum MA, et al. Interlaboratory study of quality control isolates for a broth microdilution method (modified CLSI M38-A) for testing susceptibilities of dermatophytes to antifungals. J. Clin. Microbiol. 44: 4353-4356, 2006.
Tsui CK, et al. Re-examining the phylogeny of clinically relevant Candida species and allied genera based on multigene analyses. FEMS Yeast Res. 8: 651-659, 2008. PubMed: 18248416
Borman AM, et al. Candida nivariensis, an emerging pathogenic fungus with multidrug resistance to antifungal agents. J. Clin. Microbiol. 46: 933-938, 2008. PubMed: 18199788
Kahn JN, et al. Acquired echinocandin resistance in a Candida krusei isolate due to modification of glucan synthase. Antimicrob. Agents Chemother. 51: 1876-1878, 2007. PubMed: 17325225
Innings A, et al. Multiplex real-time PCR targeting the RNase P RNA gene for detection and identification of Candida species in blood. J Clin Microbiol 45: 874-880, 2007. PubMed: 17215340
Park S, et al. Specific substitutions in the echinocandin target Fks1p account for reduced susceptibility of rare laboratory and clinical Candida sp. isolates. Antimicrob. Agents Chemother. 49: 3264-3273, 2005. PubMed: 16048935
type strain of Candida krusei
