Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Yes
GCGGAAGGATCATTAGTGATTGCCTTCTAGGCTTAAACTATATCCACATACACCTGTGAACTGTTCTACCACTTGACGCAAGTCGAGTGTTTTTACAAACAATGTGTAATGAACGTCGTTTTATTATAACAAAATAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAGCTTGCGCTCTCTGGTATTCCGGAGAGCATGCCTGTTTCAGTGTCATGAAATCTCAACCACTAGGGTTTCCTAATGGATTGGATTTGGGCGTTGCGATCTCTGATCGCTCGCCTTAAAAGAGTTAGCAAGTTTGACATTAATGTCTGGTGTAATAAGTTTCACTGGTTCCATTGTGTTGAAGCGTGCTTCTAATCGTCCGCAAGGACAATTACTTTGACTCTGGCCTGAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCA
Nucleotide (GenBank) : FJ545226 ITS including 5.8S rRNA gene
Nucleotide (GenBank) : JXYN00000000 Trichosporon ovoides strain JCM 9940, whole genome shotgun sequencing project
Gueho E, et al. Contributions to a revision of the genus Trichosporon. Antonie van Leeuwenhoek 61: 289-316, 1992. PubMed: 1497334
Gueho E, et al. Neotypification of the genus Trichosporon. Antonie van Leeuwenhoek 61: 285-288, 1992. PubMed: 1497333
Fell JW, et al. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int. J. Syst. Evol. Microbiol. 50: 1351-1371, 2000. PubMed: 10843082
Ishikawa H, et al. Simple and rapid method for the detection of Filobasidiella neoformans in a probiotic dairy product by using loop-mediated isothermal amplification. Int. J. Food Microbiol. 178: 107-112, 2014. PubMed: 24685682
Chagas-Neto TC, et al. Bloodstream infections due to Trichosporon spp.: species distribution, Trichosporon asahii genotypes determined on the basis of ribosomal DNA intergenic spacer 1 sequencing, and antifungal susceptibility testing. J. Clin. Microbiol. 47: 1074-1081, 2009. PubMed: 19225102
Sugita T, et al. Sequence analysis of the ribosomal DNA intergenic spacer 1 regions of Trichosporon species. J. Clin. Microbiol. 40: 1826-1830, 2002. PubMed: 11980969
Scorzetti G, et al. Systematics of basidiomycetous yeasts: a comparison of large subunit D1/D2 and internal transcribed spacer rDNA regions. FEMS Yeast Res. 2: 495–517, 2002. PubMed: 12702266
