Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Yes
TTGTAGCTGGCCTCTCGGGGCATGTGCACGCCTGGCTCATCCACTCTTCAACCTCTGTGCACTTGTTGTAGGTCGGTAGAAGAGCGAGCATCCTCTGATGCTTTGCTTGGAAGCCTTCCTATGTTTTACTACAAACGCTTCAGTTTAAGAATGTCTACCTGCGTACAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCTGGTATTCCGGGGAGCATGCCTGTTTGAGTGTCATGGTATCCTCAACCTTCATAACTTTTTGGTATCCAAAGGTTGGACTTGGAAGGTGGGGTGGGTTCCAATCCAAGCCGGTCCTCCTAAATGGTTTAACGGGAGTGGTACCGAACCCTTCCGTGGGGATATTAACTGGCCCCGGGTCCTGAAATAACCTTAGCTTGGCCTTCCTAACCGCCTTCCATTGGAACAACTAACTTGACCTCCGAACTTCAAACCAGGTAGACTACCCGCTTAAACTTAGCATTACCATAGGCCGAAGAAAGCCCCGGGCCACCCCCCTTCACCCC
Nucleotide (GenBank) : MJGA00000000 Phanerochaete chrysosporium strain ATCC 20696, whole genome shotgun sequencing project
Ma B, et al. Novel promoter sequence required for manganese regulation of manganese peroxidase isozyme 1 gene expression in Phanerochaete chrysosporium. Eukaryot Cell 3: 579-588, 2004. PubMed: 15189980
Ma B, Mayfield MB, Gold MH. The green fluorescent protein gene functions as a reporter of gene expression in Phanerochaete chrysosporium. Appl Environ Microbiol 67: 948-955, 2001. PubMed: 11157267
Reddy GV, Gold MH. Degradation of pentachlorophenol by Phanaerochaete chrysosporium: intermediates and reactions involved. Microbiology 146: 405-413, 2000. PubMed: 10708379
Akileswaran L, et al. 1,4-benzoquinone reductase from Phanerochaete chrysosporium: cDNA cloning and regulation of expression. Appl Environ Microbiol 65: 415-421, 1999. PubMed: 9925562
Gettemy JM, et al. Reverse transcription-PCR analysis of the regulation of the manganese peroxidase gene family. Appl. Environ. Microbiol. 64: 569-574, 1998. PubMed: 9464395
Li B, Renganathan V. Gene cloning and characterization of a novel cellulose-binding beta-glucosidase from Phanerochaete chrysosporium. Appl Environ Microbiol 64: 2748-2754, 1998. PubMed: 9647863
Gettemy JM, et al. Truncated-gene reporter system for studying the regulation of manganese peroxidase expression. Curr. Genet. 31: 519-524, 1997. PubMed: 9211796
Alic M, Akileswaran L, Gold MH. Characterization of the gene encoding manganese peroxidase isozyme 3 from Phanerochaete chrysosporium. Biochim Biophys Acta 1338: 1-7, 1997. PubMed: 9074609
Li B, Nagalla SR, Renganathan V. Cellobiose dehydrogenase from Phanerochaete chrysosporium is encoded by two allelic variants. Appl Environ Microbiol 63: 796-799, 1997. PubMed: 9023960
Li B, Nagalla SR, Renganathan V. Cloning of a cDNA encoding cellobiose dehydrogenase, a hemoflavoenzyme from Phanerochaete chrysosporium. Appl Environ Microbiol 62: 1329-1335, 1996. PubMed: 8919793
Pacepavicius GJ, et al. Assessment of cyanazine persistence in water. Environ. Toxicol. Water Qual. 11: 27-36, 1996.
Brock BJ, et al. Purification and characterization of a 1,4-benzoquione reductase from the basidiomycete Phanerochaete chrysosporium. Appl. Environ. Microbiol. 61: 3076-3081, 1995.
Lymar ES, et al. Purification and characterization of a cellulose-binding beta-glucosidase from cellulose-degrading cultures of Phanerochaete chrysosporium. Appl. Environ. Microbiol. 61: 2976-2980, 1995.
Liu D, et al. Microbial transformation of metolachlor. Environ. Toxicol. Water Qual. 10: 249-258, 1995.
Fukui H, et al. Improved conditions for biodelignification of deinked pulp by enzymes from Phanerochaete chrysosporium. Cellul. Chem. Technol. 26: 701-711, 1992.
Lebron CA, et al. Biodegradation of 2,4,6-trinitrotoluene by white-rot fungus. US Patent 5,085,998 dated Feb 4 1992
Cripps C, et al. Biodegradation of azo and heterocyclic dyes by Phanerochaete chrysosporium. Appl. Microbiol. 56: 1114-1118, 1990. PubMed: 2339873
