Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGAGTAACTGAACAGGTTGTAGCTGGCCTCTCGGGGCATGTGCACGCCTGGCTCATCCACTCTTCAACCTCTGTGCACTTGTTGTAGGTCGGTAGAAGAGCGAGCATCCTCTGATGCTTTGCTTGGAAGCCTTCCTATGTTTTACTACAAACGCTTCAGTTTAAGAATGTCTACCTGCGTATAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCTGGTATTCCGGGGAGCATGCCTGTTTGAGTGTCATGGTATCCTCAACCTTCATAACTTTTTGTTATCGAAGGCTTGGACTTGGAGGTTGTGCTGGCTTCTAGTCGAGTCGGCTCCTCTTAAATGTATTAGCGTGAGTGTAACGGATCGCTTCGGTGTGATAATTATCTGCGCCGTGGTCGTGAAGTAACATAAGCTTGCGCTTCTAACCGTCCTTCAGTTGGACAACTTACTTTGACATCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA
ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGTCTTTGGCTGTCCGAGTTGTAATCTGGAGAAGCGTCTTCCGCGCTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTCTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTTGCTAGGACTCAGCCTGGTTTCGGCCTGGTGCACTTCCTAGTAAACGGGCCAGCATCACTTTTGGCTGCGGGAAAAAGGTTAGAGGAATGTGGCACCCTCGGGTGTGTTATAGCCTCTAGCTGTATACCGTGGCTGGGAGTGAGGAACTCAGCACGCCTTCTGGCGGGGCTTCGGCCACCTTCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGAC
Nucleotide (GenBank) : Z22527 CBHI.2 gene encoding cellulase
Nucleotide (GenBank) : Z22528 CBHI.1 gene encoding cellulase
Nucleotide (GenBank) : M22220 exo-cellobiohydrolase I (cbhI) gene, complete coding sequence
Nucleotide (GenBank) : Z29653 CBHI.2 mRNA for cellulase
Yajima Y, et al. Vanillate hydroxylase from the white rot basidiomycete Phanerochaete chrysosporium. Arch. Microbiol. 123: 319-321, 1979.
Kirk TK, et al. Preparation and microbial decomposition of synthetic [14C] lignins. Proc. Natl. Acad. Sci. USA 72: 2515-2519, 1975. PubMed: 1058470
Weinstein DA, et al. Metabolism of radiolabeled beta-guaiacyl ether-linked lignin dimeric compounds by Phanerochaete chrysosporium. Appl. Environ. Microbiol. 39: 535-540, 1980.
Enoki A, et al. Metabolism of the lignin model compounds veratrylglycerol-beta-guaiacyl ether and 4-ethoxy-3-methoxyphenylglycerol-beta-guaiacyl ether by Phanerochaete chrysosporium. Arch. Microbiol. 125: 227-232, 1980.
Kuwahara M. Separation and characterization of two extracellular H2O2-dependent oxidases from ligninolytic cultures of Phanerochaete chrysosporium. FEBS Lett. 169: 247-250, 1984.
Kelley RL, Reddy CA. Purification and characterization of glucose oxidase from ligninolytic cultures of Phanerochaete chrysosporium. J. Bacteriol. 166: 269-274, 1986. PubMed: 3957868
Ducrocq C, et al. Formation of glyceryl 2-mononitrate by regioselective bioconversion of glyceryl trinitrates. Efficiency of the filamentous fungus Phanerochaete chrysosporium. Biotechnol. Appl. Biochem. 12: 325-330, 1990. PubMed: 2113815
Randall TA, Reddy CA. The nature of extra-chromosomal maintenance of transforming plasmids in the filamentous basidiomycete Phanerochaete chrysosporium. Curr. Genet. 21: 255-260, 1992. PubMed: 1314140
Copa-Patino JL, et al. Production and initial characterisation of the xylan-degrading system of Phanerochaete chrysosporium. Appl. Microbiol. Biotechnol. 40: 69-76, 1993.
. . Appl. Environ. Microbiol. 32: 192-194, 1976.
Yadav JS, Reddy CA. Degradation of benzene, toluene, ethylbenzene, and xylenes (BTEX) by the lignin-degrading basidiomycete Phanerochaete chrysosporium. Appl. Environ. Microbiol. 59: 756-762, 1993. PubMed: 8481002
Burdsall HH Jr., Eslyn WE. A new Phanerochaete with a Chrysosporium imperfect state. Mycotaxon 1: 123-133, 1974.
Kelley RL, Reddy CA. Identification of glucose oxidase activity as the primary source of hydrogen peroxide production in ligninolytic cultures of Phanerochaete chrysosporium. Arch. Microbiol. 144: 248-253, 1986.
Sims PF, et al. Differential expression of multiple exo-cellobiohydrolase I-like genes in the lignin-degrading fungus Phanerochaete chrysosporium. Mol. Microbiol. 12: 209-216, 1994. PubMed: 8057846
Costa-Ferreira M, et al. On the relationship between cellobiose dehydrogenase and cellobiose:quinone oxidoreductase under condtions where [14C]DHP is mineralized by whole cultures of Phanerochaete chrysosporium. Enzyme Microb. Technol. 16: 771-776, 1994.
Yesilada O. Decolourization of crystal violet by fungi. World J. Microbiol. Biotechnol. 11: 601-602, 1995.
Bumpus JA, Aust SD. Biodegradation of DDT [1,1,1-trichloro-2,2-bis(4-chlorophenyl)ethane] by the white rot fungus Phanerochaete chrysosporium. Appl. Environ. Microbiol. 53: 2001-2008, 1987. PubMed: 3674869
Dhawale SW, et al. Degradation of phenanthrene by Phanerochaete chrysosporium occurs under ligninolytic as well as nonligninolytic conditions. Appl. Environ. Microbiol. 58: 3000-3006, 1992. PubMed: 1444413
Alleman BC, et al. Toxicity of pentachlorophenol to six species of white rot fungi as a function of chemical dose. Appl. Environ. Microbiol. 58: 4048-4050, 1992.
Sutherland JB, et al. Enantiomeric composition of the trans-dihydrodiols produced from phenanthrene by fungi. Appl. Environ. Microbiol. 59: 2145-2149, 1993.
Yadav JS, Reddy CA. Mineralization of 2,4-dichlorophenoxyacetic acid (2,4-D) and mixtures of 2,4-D and 2,4,5-trichlorophenoxyacetic acid by Phanerochaete chrysosporium. Appl. Environ. Microbiol. 59: 2904-2908, 1993.
Yadav JS, et al. Degradation of polychlorinated biphenyl mixtures (Aroclors 1242, 1254, and 1260) by the white rot fungus Phanerochaete chrysosporium as evidenced by congener-specific analysis. Appl. Environ. Microbiol. 61: 2560-2565, 1995. PubMed: 7618867
Watanabe A, et al. Purification and characterization of an aryl-alcohol oxidase from the lignin-degrading basidiomyte Phanerochaete chrysosporium. Biosci. Biotechnol. Biochem. 59: 1339-1341, 1995.
Sims P, et al. The identification, molecular cloning and characterisation of a gene from Phanerochaete chrysosporium that shows strong homology to the exo- cellobiohydrolase I gene from Trichoderma reesei. Gene 74: 411-422, 1988. PubMed: 3246351
Lundquist K, Kirk TK. De novo synthesis and decomposition veratryl alcohol by a lignin-degrading basidiomycete. Phytochemistry 17: 1676, 1978.
Asada Y, et al. An extracellular NADH-oxidizing peroxidase produced by a lignin-degrading basidiomycete, Phanerochaete chrysosporium. J. Ferment. Technol. 65: 483-487, 1987.
Watanabe T, et al. Characterization of a Delta12-fatty acid desaturase gene from Ceriporiopsis subvermispora, a selective lignin-degrading fungus. Appl Microbiol Biotechnol 87: 215-224, 2010. PubMed: 20155356
Pointing SB, et al. Screening of basidiomycetes and xylariaceous fungi for lignin peroxidase and laccase gene-specific sequences. Mycol Res 109: 115-124, 2005. PubMed: 15736869
Hart DO, et al. Identification of Asp-130 as the catalytic nucleophile in the main alpha-galactosidase from Phanerochaete chrysosporium, a family 27 glycosyl hydrolase. Biochemistry 39: 9826-9836, 2000. PubMed: 10933800
